grma

Ensembl ID:
ENSDARG00000025671
ZFIN ID:
ZDB-GENE-021120-2
Description:
glutamate receptor, metabotropic a [Source:RefSeq peptide;Acc:NP_001073489]
Human Orthologue:
GRM6
Human Description:
glutamate receptor, metabotropic 6 [Source:HGNC Symbol;Acc:4598]
Mouse Orthologue:
Grm6
Mouse Description:
glutamate receptor, metabotropic 6 Gene [Source:MGI Symbol;Acc:MGI:1351343]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10723 Essential Splice Site Available for shipment Available now
sa17675 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033657 Essential Splice Site 354 905 5 12
ENSDART00000114226 Essential Splice Site 358 909 4 11
ENSDART00000143677 Essential Splice Site 358 909 5 12
Genomic Location:
Chromosome 11 (position 26591322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCTGAGGGTGCAGTAACCATCTTGCCCAAACGGGCATCCATTGAAGG[T/C]AAAAACTAAAGGCACATGTTAKTGTAATTAATGRAGGAAAAATGTGKTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033657 Nonsense 855 905 11 12
ENSDART00000114226 Nonsense 859 909 10 11
ENSDART00000143677 Nonsense 859 909 11 12
Genomic Location:
Chromosome 11 (position 26609092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTGAGTGCCACGGTGTCCCTGGGCATGTTGTACATCCCCAAAGTCTA[T/A]GTCATCATCTTCCACCCCGAGCAGAAYGTGCAGAAGCGCAAGCGCAGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/23gma9yb