or111-2

Ensembl ID:
ENSDARG00000025658
ZFIN ID:
ZDB-GENE-010308-19
Description:
odorant receptor, family D, subfamily 111, member 2 [Source:RefSeq peptide;Acc:NP_001122244]
Human Orthologues:
OR2AT4, OR6K2, OR6K3, OR6K6, OR6N1, OR6N2
Human Descriptions:
olfactory receptor, family 2, subfamily AT, member 4 [Source:HGNC Symbol;Acc:19620]
olfactory receptor, family 6, subfamily K, member 2 [Source:HGNC Symbol;Acc:15029]
olfactory receptor, family 6, subfamily K, member 3 [Source:HGNC Symbol;Acc:15030]
olfactory receptor, family 6, subfamily K, member 6 [Source:HGNC Symbol;Acc:15033]
olfactory receptor, family 6, subfamily N, member 1 [Source:HGNC Symbol;Acc:15034]
olfactory receptor, family 6, subfamily N, member 2 [Source:HGNC Symbol;Acc:15035]
Mouse Orthologues:
Olfr231, Olfr420, Olfr421, Olfr424, Olfr427, Olfr429, Olfr430, Olfr520, Olfr521
Mouse Descriptions:
olfactory receptor 231 Gene [Source:MGI Symbol;Acc:MGI:3030065]
olfactory receptor 420 Gene [Source:MGI Symbol;Acc:MGI:3030254]
olfactory receptor 421 Gene [Source:MGI Symbol;Acc:MGI:3030255]
olfactory receptor 424 Gene [Source:MGI Symbol;Acc:MGI:3030258]
olfactory receptor 427 Gene [Source:MGI Symbol;Acc:MGI:3030261]
olfactory receptor 429 Gene [Source:MGI Symbol;Acc:MGI:3030263]
olfactory receptor 430 Gene [Source:MGI Symbol;Acc:MGI:3030264]
olfactory receptor 520 Gene [Source:MGI Symbol;Acc:MGI:3030354]
olfactory receptor 521 Gene [Source:MGI Symbol;Acc:MGI:3030355]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11838 Nonsense Available for shipment Available now
sa13698 Nonsense Available for shipment Available now
sa15058 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060122 Nonsense 207 326 2 2
ENSDART00000127485 Nonsense 223 342 2 2
ENSDART00000060122 Nonsense 207 326 2 2
ENSDART00000127485 Nonsense 223 342 2 2
Genomic Location:
Chromosome 15 (position 30654397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTAGGTTGGCTTGWAATGACAATAGCATGAATAAGATTATGGCDTA[T/A]GTCATTTCAGTTCTGTACATTTTAGCACCAATGGTCGTTATCGTCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060122 Nonsense 207 326 2 2
ENSDART00000127485 Nonsense 223 342 2 2
ENSDART00000060122 Nonsense 207 326 2 2
ENSDART00000127485 Nonsense 223 342 2 2
Genomic Location:
Chromosome 15 (position 30654397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTAGGTTGGCTTGWAATGACAATAGCATGAATAAGATTATGGCDTA[T/A]GTCATTTCAGTTCTGTACATTTTAGCACCAATGGTCGTTATCGTCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060122 Nonsense 232 326 2 2
ENSDART00000127485 Nonsense 248 342 2 2
Genomic Location:
Chromosome 15 (position 30654323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACCAATGGTCGTTATCGTCTTTTCATATCTGGSCATTTTTCTWGCTT[T/A]AATCAAAATCACAACTTGGGAAGGACGATTAAAAGCACTRAAGACCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/emrt57uk