gli2a

Ensembl ID:
ENSDARG00000025641
ZFIN ID:
ZDB-GENE-990706-8
Description:
GLI-Kruppel family member GLI2a [Source:RefSeq peptide;Acc:NP_571042]
Human Orthologue:
GLI2
Human Description:
GLI family zinc finger 2 [Source:HGNC Symbol;Acc:4318]
Mouse Orthologue:
Gli2
Mouse Description:
GLI-Kruppel family member GLI2 Gene [Source:MGI Symbol;Acc:MGI:95728]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21538 Essential Splice Site Available for shipment Available now
sa15798 Nonsense Available for shipment Available now
sa21539 Nonsense Available for shipment Available now
sa12847 Nonsense Available for shipment Available now
sa15237 Nonsense Available for shipment Available now
sa41479 Nonsense Mutation detected in F1 DNA During 2016
sa10919 Nonsense Available for shipment Available now
sa21540 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Essential Splice Site 39 1439 2 14
Genomic Location (Zv9):
Chromosome 9 (position 38227004)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37364900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTCACAGACCTTCCCAAAAAGCCCTCACCCACCACAGCATCCAGAGG[T/C]ACAGTACGATTATCCCCCTACAGCTAAAGAAAATGAACCAACACAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Nonsense 167 1439 5 14
Genomic Location (Zv9):
Chromosome 9 (position 38307799)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37445695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTGGCCTCCCTCCTCCGCCTCCTGGAGCAAACCCTTCAGAGTACTA[T/A]CACCTCATCGCCAGCCACCGTAGCCCTTATGGAGACCTGCTCATGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Nonsense 689 1439 13 14
Genomic Location (Zv9):
Chromosome 9 (position 38345320)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37483216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTACCGGTTCTCCAGGTACTTCTGCTGGAGTTGGTCTCCAGCTGCGT[A/T]AAAACAGGGCGGGACTACTACAGCTTGAGCACATCAAGAAGGAAAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Nonsense 929 1439 14 14
Genomic Location (Zv9):
Chromosome 9 (position 38346324)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37484220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTACGGTGCCCCTGGCATRAKGCCTCATGAAGTTCCRGCCAATCTTCCA[C/T]GACGAGCAAGYGATCCTGTTCGTCGTACAACTCTTGACCCACTCTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Nonsense 977 1439 14 14
Genomic Location (Zv9):
Chromosome 9 (position 38346470)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37484366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCTGCCTGCATAYGATCGACGTGCTTTCAACATGCAGAACAACACTTG[G/A]TCTGATGGAAGCTTGCACCGTCATCCCTTCAGCCAAAGGCCACCTAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Nonsense 1081 1439 14 14
Genomic Location (Zv9):
Chromosome 9 (position 38346780)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37484676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGGGCATGGCAAGCATCAATGGAAGTCACGTAGAGCCTGTTCCAGAA[C/T]AAATAGCTGATCCGCAGGGCATGAACAAAAACAACATGCCTGTGCAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Nonsense 1253 1439 14 14
Genomic Location (Zv9):
Chromosome 9 (position 38347296)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37485192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTCCTCTAACTCAGACAGCTWTTCAGAATGCAGGCAGAGGACTGATA[C/T]AGCCCAGACCTCCGTCCGAACCCAAACCATTGAATAGGCAACACTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024555 Nonsense 1423 1439 14 14
Genomic Location (Zv9):
Chromosome 9 (position 38347807)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37485703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTCAGTACCGGCAGGTATTGGCAACATGGCTATTGGTGACATGAGCT[C/A]AATGTTAACGGCCCTTGCGGAAGAAAGCAAATTCTTAAACATGATGGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link