casp6l1

Ensembl ID:
ENSDARG00000025608
ZFIN ID:
ZDB-GENE-041010-48
Description:
caspase 6, apoptosis-related cysteine peptidase, like 1 [Source:RefSeq peptide;Acc:NP_001005973]
Human Orthologue:
CASP6
Human Description:
caspase 6, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1507]
Mouse Orthologue:
Casp6
Mouse Description:
caspase 6 Gene [Source:MGI Symbol;Acc:MGI:1312921]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1603 Essential Splice Site Available for shipment Available now
sa10094 Nonsense Available for shipment Available now
sa40102 Nonsense Mutation detected in F1 DNA During 2016
sa38400 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041414   None 242 None 6
ENSDART00000125012 Essential Splice Site 11 569 1 15
ENSDART00000136919   None 249 None 6
ENSDART00000146586   None 169 None 6
ENSDART00000147374   None 253 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 33102708)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32834018
KASP Assay ID:
554-1544.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCATTCACATAAATAACGATGGCAAGTCACACTAAGAGCGACGGATCCGG[T/A]AAGGGATTAGTTTAGTTTCTCTGTATGGAGATAAATAACTTGAATGTGTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041414   None 242 None 6
ENSDART00000125012 Nonsense 66 569 4 15
ENSDART00000136919   None 249 None 6
ENSDART00000146586   None 169 None 6
ENSDART00000147374   None 253 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 33101569)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32832879
KASP Assay ID:
2259-3702.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAAGAGACGGGGAATGGCTCTCATATTTAATCATGAAAATTTCTTTT[G/A]GAAACTGGGATTGGGCTACCGTTCTGGAACRAATGCAGACAAGGAGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041414   None 242 None 6
ENSDART00000125012 Nonsense 100 569 5 15
ENSDART00000136919   None 249 None 6
ENSDART00000146586   None 169 None 6
ENSDART00000147374   None 253 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 33101353)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32832663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGTAGATTTCGAGAGCTGAATTTTGAAGTTAAAGCTTTTGATGATTA[C/A]AAACGACATGAAGTTTTGTCCAAAATCACAGAGGGTATGTGTTGCTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041414 Essential Splice Site 162 242 None 6
ENSDART00000125012 Essential Splice Site 489 569 None 15
ENSDART00000136919 Essential Splice Site 169 249 None 6
ENSDART00000146586   169 169 6 6
ENSDART00000147374 Essential Splice Site 199 253 None 7
Genomic Location (Zv9):
Chromosome 3 (position 33091850)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32823160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTTCCAGCAGGAGCAGATTTCATTATGTGTTACTCAACAGCTGAAGG[T/G]CAGTGTTTATATCTTTGTTTCGTTTTACTGAGATTTTATTATTGTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link