ifnphi1

Ensembl ID:
ENSDARG00000025607
ZFIN ID:
ZDB-GENE-030721-3
Description:
interferon phi 1 [Source:RefSeq peptide;Acc:NP_997523]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu7894 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu7894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029823 Nonsense 194 195 7 7
ENSDART00000029849 Nonsense 184 185 5 5

The following transcripts of ENSDARG00000025607 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 22575934)
KASP Assay ID:
554-2422.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATTTATTTTTTGGTCATTATATCAGATCATATCATCTGTTACACTC[G/A]AGGATTGACCCTTGCGTTGCTTGCGATGATGTCCATCCTCTGAAGGTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ylpi0rrz