nvl

Ensembl ID:
ENSDARG00000025605
ZFIN ID:
ZDB-GENE-040426-2871
Description:
nuclear valosin-containing protein-like [Source:RefSeq peptide;Acc:NP_998649]
Human Orthologue:
NVL
Human Description:
nuclear VCP-like [Source:HGNC Symbol;Acc:8070]
Mouse Orthologue:
Nvl
Mouse Description:
nuclear VCP-like Gene [Source:MGI Symbol;Acc:MGI:1914709]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42107 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42106 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038315 Essential Splice Site 316 796 10 23

The following transcripts of ENSDARG00000025605 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 396714)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 394697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGGAGAGTCTGAGCAGAAGCTGCGGGAGCTGTTCGAGCAGGCCATC[G/T]TAAGAGAAACACACAACACATTTACAGCGCTACATTCATTCAGTTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038315 Nonsense 482 796 14 23

The following transcripts of ENSDARG00000025605 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 393923)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 391906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTCTGGCTCGTCTGCTGGATCTCCTGAAGAGCAGTGTTTCTCTGAGT[G/T]AGGATCAGCTGGCGGCTCTCTGCGTCCTCATGTCAGACTTCAGCTCTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link