tmem195

Ensembl ID:
ENSDARG00000025595
ZFIN ID:
ZDB-GENE-040426-2207
Description:
Alkylglycerol monooxygenase [Source:UniProtKB/Swiss-Prot;Acc:Q6NYE4]
Human Orthologue:
TMEM195
Human Description:
transmembrane protein 195 [Source:HGNC Symbol;Acc:33784]
Mouse Orthologue:
Tmem195
Mouse Description:
transmembrane protein 195 Gene [Source:MGI Symbol;Acc:MGI:2442495]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22691 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034746 Nonsense 58 446 2 13
ENSDART00000139934 Nonsense 42 330 2 10
ENSDART00000147582 Nonsense 70 458 2 13
Genomic Location:
Chromosome 15 (position 33700782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACGCCATATTTCATTGGCTTGATATTATTGGAGATTGTGTTGGGCTG[G/A]TTAAAGACAGATGGCCCTCACATTAAGATCAACGACTTCATTACGTCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Fasting insulin-related traits: New genetic loci implicated in fasting glucose homeostasis and their impact on type 2 diabetes risk. (View Study)
  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yr81zs4w