
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tmem195
- Ensembl ID:
- ENSDARG00000025595
- ZFIN ID:
- ZDB-GENE-040426-2207
- Description:
- Alkylglycerol monooxygenase [Source:UniProtKB/Swiss-Prot;Acc:Q6NYE4]
- Human Orthologue:
- TMEM195
- Human Description:
- transmembrane protein 195 [Source:HGNC Symbol;Acc:33784]
- Mouse Orthologue:
- Tmem195
- Mouse Description:
- transmembrane protein 195 Gene [Source:MGI Symbol;Acc:MGI:2442495]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22691 | Nonsense | Available for shipment | Available now |
sa35954 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44828 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa35953 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22691
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034746 | Nonsense | 58 | 446 | 2 | 13 |
ENSDART00000139934 | Nonsense | 42 | 330 | 2 | 10 |
ENSDART00000147582 | Nonsense | 70 | 458 | 2 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 33700782)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34546558 GRCz11 15 34404527 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCACGCCATATTTCATTGGCTTGATATTATTGGAGATTGTGTTGGGCTG[G/A]TTAAAGACAGATGGCCCTCACATTAAGATCAACGACTTCATTACGTCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35954
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034746 | Nonsense | 165 | 446 | 4 | 13 |
ENSDART00000139934 | Nonsense | 149 | 330 | 4 | 10 |
ENSDART00000147582 | Nonsense | 177 | 458 | 4 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 33671663)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34517439 GRCz11 15 34375408 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGTTCTGAATACTACAATCTGTCGACAGCTCTGCGCCAGTCTGTCACA[C/T]AGCAGTTTTCCTCATGGGTATGAAGCACCTGCGTCTGTCTCATTCATTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44828
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034746 | Nonsense | 190 | 446 | 5 | 13 |
ENSDART00000139934 | Nonsense | 174 | 330 | 5 | 10 |
ENSDART00000147582 | Nonsense | 202 | 458 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 33671442)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34517218 GRCz11 15 34375187 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCTCCGTTGGCGCTGCTGATTCCTCCTTCAGTGTTTGCGGTACATATA[C/T]AGTTCAACCTGCTGTACCAGTTCTGGATTCATACTGAGGTATTGTGGGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35953
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000034746 | Essential Splice Site | 225 | 446 | 6 | 13 |
ENSDART00000139934 | Essential Splice Site | 209 | 330 | 6 | 10 |
ENSDART00000147582 | Essential Splice Site | 237 | 458 | 6 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 33664410)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34510186 GRCz11 15 34368155 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCTGGAGTTGATCCTAAATACTCCAAGCCACCACAGAGTTCACCACGG[T/C]AAGCATCATTACCCTTTGAAAGTAGATTTGCATTGGTGTGTGTTATCTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Fasting insulin-related traits: New genetic loci implicated in fasting glucose homeostasis and their impact on type 2 diabetes risk. (View Study)
- Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: