mkln1

Ensembl ID:
ENSDARG00000025576
ZFIN ID:
ZDB-GENE-030131-3942
Description:
muskelin [Source:RefSeq peptide;Acc:NP_997859]
Human Orthologue:
MKLN1
Human Description:
muskelin 1, intracellular mediator containing kelch motifs [Source:HGNC Symbol;Acc:7109]
Mouse Orthologue:
Mkln1
Mouse Description:
muskelin 1, intracellular mediator containing kelch motifs Gene [Source:MGI Symbol;Acc:MGI:1351638]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13831 Essential Splice Site Available for shipment Available now
sa11959 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028820 None None 202 None 6
ENSDART00000036354 Essential Splice Site 480 750 11 18
ENSDART00000137736 Essential Splice Site 459 729 11 18
Genomic Location:
Chromosome 4 (position 10777689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCGGAGGAYATCCAATCTCGCATCGGACACTGCATGCTCTTCCACACG[G/A]TGCGTCTCCTTAGTAATGACCCATAAAGTGATACATTGAKGCTTGTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028820 Essential Splice Site 25 202 1 6
ENSDART00000036354 None None 750 None 18
ENSDART00000137736 None None 729 None 18
Genomic Location:
Chromosome 4 (position 10788450)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATCTGCTGCTGYTTTCTGTCACTTTTTGTTTATTTGACTCGATTTGG[G/A]TGGGTGCGTGTGTKTGTACACTTTGCTTGGACGGTATGCGCTGTTTAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o086w6wf