mkln1

Ensembl ID:
ENSDARG00000025576
ZFIN ID:
ZDB-GENE-030131-3942
Description:
muskelin [Source:RefSeq peptide;Acc:NP_997859]
Human Orthologue:
MKLN1
Human Description:
muskelin 1, intracellular mediator containing kelch motifs [Source:HGNC Symbol;Acc:7109]
Mouse Orthologue:
Mkln1
Mouse Description:
muskelin 1, intracellular mediator containing kelch motifs Gene [Source:MGI Symbol;Acc:MGI:1351638]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40245 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13831 Essential Splice Site Available for shipment Available now
sa11959 Essential Splice Site Available for shipment Available now
sa31383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028820   None 202 None 6
ENSDART00000036354 Essential Splice Site 276 750 8 18
ENSDART00000137736 Essential Splice Site 255 729 8 18
Genomic Location (Zv9):
Chromosome 4 (position 10774218)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11710845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACACGCACCACTTCTTATTGTTTTTTTTGTTTTTAACTTTCTGATTA[G/A]GCGATGGTGATGATAACAGGCCGGGCATGAGAGGAGGTCATCAAATGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028820   None 202 None 6
ENSDART00000036354 Essential Splice Site 480 750 11 18
ENSDART00000137736 Essential Splice Site 459 729 11 18
Genomic Location (Zv9):
Chromosome 4 (position 10777689)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11714316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCGGAGGAYATCCAATCTCGCATCGGACACTGCATGCTCTTCCACACG[G/A]TGCGTCTCCTTAGTAATGACCCATAAAGTGATACATTGAKGCTTGTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028820 Essential Splice Site 25 202 1 6
ENSDART00000036354   None 750 None 18
ENSDART00000137736   None 729 None 18
Genomic Location (Zv9):
Chromosome 4 (position 10788450)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11725077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATCTGCTGCTGYTTTCTGTCACTTTTTGTTTATTTGACTCGATTTGG[G/A]TGGGTGCGTGTGTKTGTACACTTTGCTTGGACGGTATGCGCTGTTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028820 Nonsense 29 202 2 6
ENSDART00000036354 Nonsense 577 750 14 18
ENSDART00000137736 Nonsense 556 729 14 18
Genomic Location (Zv9):
Chromosome 4 (position 10788542)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11725169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTAGTGTGAAAGACTAACTGTGTGTTTGTTTACAGGTCCTGTGTTTA[T/G]AAGAACGACCAAGCGGTGAAGGAAAACCCCACTAAGGCCCTGCAGGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link