ndufaf1

Ensembl ID:
ENSDARG00000025549
ZFIN ID:
ZDB-GENE-050306-9
Description:
complex I intermediate-associated protein 30, mitochondrial [Source:RefSeq peptide;Acc:NP_001013326
Human Orthologue:
NDUFAF1
Human Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 [Source:HGNC Symbol;Acc:18828]
Mouse Orthologue:
Ndufaf1
Mouse Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42242 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035940   None 304 None 4
ENSDART00000131985 Essential Splice Site None 184 None 3
ENSDART00000132834 Essential Splice Site None 172 None 3
ENSDART00000136356 Splice Site None 290 2 5
ENSDART00000141912 Essential Splice Site None 95 None 4
ENSDART00000144379 Essential Splice Site None 304 None 7
ENSDART00000148368 Splice Site None 32 3 3

The following transcripts of ENSDARG00000025549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33471758)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33117706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCATATACGATTTTACTGTTTGTTATAAATGTTTTTAATTTTTTCAGC[A/T]GTCTTCTGGATGTCTAATCTGATCCCAAGAGCTACCCAGACTAAATGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link