sgk1

Ensembl ID:
ENSDARG00000025522
ZFIN ID:
ZDB-GENE-030131-2860
Description:
Serine/threonine-protein kinase Sgk1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTW4]
Human Orthologue:
SGK1
Human Description:
serum/glucocorticoid regulated kinase 1 [Source:HGNC Symbol;Acc:10810]
Mouse Orthologue:
Sgk1
Mouse Description:
serum/glucocorticoid regulated kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1340062]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3228 Nonsense F2 line generated During 2017
sa24374 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3228
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035031 Nonsense 66 433 3 10
ENSDART00000133569 Nonsense 48 264 3 7
ENSDART00000145621 Nonsense 47 229 3 6
ENSDART00000146327 Nonsense 231 305 7 8

The following transcripts of ENSDARG00000025522 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31883462)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31718352
KASP Assay ID:
554-3092.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTCTTGCAGTCCTGAGGTTCAGTCCATCCTAAACCTGACACCACCA[C/T]AAGATGTGGAGCTAATGAACAGCAACCCTTCCCCTCCGGTAAATCTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035031 Nonsense 180 433 5 10
ENSDART00000133569 Nonsense 162 264 5 7
ENSDART00000145621 Nonsense 161 229 5 6
ENSDART00000146327   None 305 None 8

The following transcripts of ENSDARG00000025522 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31882908)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31717798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCATTACTCTTTCCAGACCACTGATAAACTCTACTTCGTACTGGACTA[C/A]ATCAATGGAGGAGAGGTGTGTACTTTAATAAGCAAGACATTACAAACAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link