si:ch73-335d12.2

Ensembl ID:
ENSDARG00000025505
ZFIN ID:
ZDB-GENE-060503-423
Description:
hypothetical protein LOC555932 [Source:RefSeq peptide;Acc:NP_001076271]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20848 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060333 Essential Splice Site 246 366 3 4
ENSDART00000146304   None 250 None 3
Genomic Location (Zv9):
Chromosome 7 (position 3958019)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3648433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAATGACATCCTTTGTGACCGCCAGTATGCTTTTGTGTGTCATGAAG[G/A]TGAGCAGATCCTCCAAACACACTCAATGCATCATCAGCTCCAGATCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link