gucy2f

Ensembl ID:
ENSDARG00000025504
ZFIN ID:
ZDB-GENE-011128-7
Description:
retinal guanylyl cyclase 2 [Source:RefSeq peptide;Acc:NP_571939]
Mouse Orthologue:
Gucy2d
Mouse Description:
guanylate cyclase 2d Gene [Source:MGI Symbol;Acc:MGI:106030]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22668 Essential Splice Site Available for shipment Available now
sa35912 Essential Splice Site Available for shipment Available now
sa42568 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099916 Essential Splice Site None 259 16 19
ENSDART00000126196 Essential Splice Site 1019 1107 15 18
Genomic Location (Zv9):
Chromosome 15 (position 28724744)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29442774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGC[G/A]TATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099916 Essential Splice Site None 259 None 19
ENSDART00000126196 Essential Splice Site 1020 1107 None 18
Genomic Location (Zv9):
Chromosome 15 (position 28724745)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29442775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGCG[T/G]ATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099916   None 259 18 19
ENSDART00000126196 Nonsense 1076 1107 17 18
Genomic Location (Zv9):
Chromosome 15 (position 28726790)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29444820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGCTTGTTGGGAAAGCTAATTTTACTAAGCCTTTGCCAAATCCACCA[G/T]AGATCAAACCAGGGTAAGATTTTAATATTATTTTAACATAATTTTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link