mtx1a

Ensembl ID:
ENSDARG00000025500
ZFIN ID:
ZDB-GENE-060606-2
Description:
metaxin 1a [Source:RefSeq peptide;Acc:NP_001121710]
Human Orthologue:
MTX1
Human Description:
metaxin 1 [Source:HGNC Symbol;Acc:7504]
Mouse Orthologue:
Mtx1
Mouse Description:
metaxin 1 Gene [Source:MGI Symbol;Acc:MGI:103025]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6445 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113714 Essential Splice Site 195 319 6 8
Genomic Location:
Chromosome 16 (position 45784500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTTCTCTCTCAGCGCCTGGGATCAAACAAATTTTTCTTTGGAGATTC[G/A]TAAGTTCGATACTTGTNNTACRTACAGTATTGGGTAGGTTACTTTAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6xcnsctb