GIPR

Ensembl ID:
ENSDARG00000025478
Description:
gastric inhibitory polypeptide receptor [Source:HGNC Symbol;Acc:4271]
Human Orthologue:
GIPR
Human Description:
gastric inhibitory polypeptide receptor [Source:HGNC Symbol;Acc:4271]
Mouse Orthologue:
Gipr
Mouse Description:
gastric inhibitory polypeptide receptor Gene [Source:MGI Symbol;Acc:MGI:1352753]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30995 Nonsense Mutation detected in F1 DNA During 2017
sa22664 Essential Splice Site Available for shipment Available now
sa22665 Essential Splice Site Available for shipment Available now
sa39053 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029459 Nonsense 66 499 3 13
Genomic Location (Zv9):
Chromosome 15 (position 28306182)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29024212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACAGATGGAGTTCCCAACACAACAGTGAAAGTGCCCTGCCCCTGGTA[T/A]CTGCCCTGGCATGATCAAGGTATTGCTGCCAACAATAGTGCCAGATGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029459 Essential Splice Site 113 499 4 13
Genomic Location (Zv9):
Chromosome 15 (position 28307382)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29025412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGACCACTCACAGTGCAATGCAGATGGCAGACAGCAGATAGCACAGG[T/C]ACAGAGACCCCAAACTCAGCATTAAAAGGTGTCACATGCTGTCACATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029459 Essential Splice Site 201 499 7 13
Genomic Location (Zv9):
Chromosome 15 (position 28316140)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29034170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGCAATGTCCAATAAAATAAACTATTAAACGCACCTTAAATCCTCAC[A/G]GGTGATGTCAGGCTGCCGTGTGGCTCAGGTCCTGATGCAGTACTGTGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029459 Nonsense 366 499 11 13
Genomic Location (Zv9):
Chromosome 15 (position 28319592)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29037622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGAGGAACAGACTGAAGGAGTACTTCGCAATGTCAACCTGTTCTTT[G/T]AACTCTTCTTCAATTCTTTTCAGGTACAACTTAGTGAATCAAGAGAGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link