bnip3la

Ensembl ID:
ENSDARG00000025468
ZFIN ID:
ZDB-GENE-030131-2283
Description:
BCL2/adenovirus E1B interacting protein 3-like a [Source:RefSeq peptide;Acc:NP_001012242]
Human Orthologue:
BNIP3L
Human Description:
BCL2/adenovirus E1B 19kDa interacting protein 3-like [Source:HGNC Symbol;Acc:1085]
Mouse Orthologue:
Bnip3l
Mouse Description:
BCL2/adenovirus E1B interacting protein 3-like Gene [Source:MGI Symbol;Acc:MGI:1332659]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41111 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035676 Essential Splice Site 103 233 2 6
Genomic Location (Zv9):
Chromosome 8 (position 5429682)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5229776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGACGCTCAACACGAGTCCAGTCCCAGCAGCTCGTCCTGCAACAGG[T/G]ACGATACCAGGACACTTTAGATGCATTTACACTGCATGGTTCAGTAGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link