aatf

Ensembl ID:
ENSDARG00000025467
ZFIN IDs:
ZDB-GENE-030131-9654, ZDB-GENE-030131-9654
Description:
protein AATF [Source:RefSeq peptide;Acc:NP_001077297]
Human Orthologue:
AATF
Human Description:
apoptosis antagonizing transcription factor [Source:HGNC Symbol;Acc:19235]
Mouse Orthologue:
Aatf
Mouse Description:
apoptosis antagonizing transcription factor Gene [Source:MGI Symbol;Acc:MGI:1929608]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12249 Nonsense Available for shipment Available now
sa20541 Essential Splice Site, Missense Available for shipment Available now
sa11464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028854 Nonsense 76 576 2 12
ENSDART00000130583 Nonsense 79 570 2 13
Genomic Location:
Chromosome 5 (position 57689329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGCGGAAACGCTCTGGGGCCATTCTGGCTGATGGTGACCAACGATA[T/A]YGTGGAAAGGCAACATCCAGAAAAGACCTACAGAAAGAKTTGGATGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028854 Missense 96 576 3 12
ENSDART00000130583 Essential Splice Site 97 570 None 13
Genomic Location:
Chromosome 5 (position 57689484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGGATTGTCCAACTCACAATATGTTTTGCACATTTTTAGCAGATGA[A/T]GATGATGATGATAATGATGATGGTGTTGATGATGAAGATGAAAGTGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028854 Nonsense 355 576 6 12
ENSDART00000130583 Nonsense 349 570 7 13
Genomic Location:
Chromosome 5 (position 57698978)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGGATGAAAATGAAGGTGATGACCAAGAGGTAGAACAGAAAGCAGCT[C/T]GAAACRGACCTCCCAAACGAAAAMTGGAAATGGCAGATTATCCCAAYTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/usg93r0x