fzd8c

Ensembl ID:
ENSDARG00000025420
ZFIN ID:
ZDB-GENE-990415-218
Description:
frizzled-5 [Source:RefSeq peptide;Acc:NP_571209]
Human Orthologue:
FZD5
Human Description:
frizzled homolog 5 (Drosophila) [Source:HGNC Symbol;Acc:4043]
Mouse Orthologue:
Fzd5
Mouse Description:
frizzled homolog 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108571]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31718 Nonsense Available for shipment Available now
sa31719 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031761 Nonsense 36 592 1 1
Genomic Location (Zv9):
Chromosome 9 (position 29266237)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28421935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGGATTTTGGCTGCATGTCCTGCTGCTGTTTCAACTGTCTGGGCTC[G/T]GAGATTCAGCCTCTAAGGATATAGTGTGTGAGCCCATCACTGTACCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031761 Nonsense 319 592 1 1
Genomic Location (Zv9):
Chromosome 9 (position 29267088)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28422786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAGCGGGTGGCTTGCGAGGGCACTGGTGACCAGCAGCACATTCTCTA[C/A]GACACCACAGGTCCTGCCCTGTGCACGCTGGTTTTTCTGCTCATTTACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link