lsm14b

Ensembl ID:
ENSDARG00000025386
ZFIN ID:
ZDB-GENE-040426-779
Description:
LSM14 homolog B-like [Source:RefSeq peptide;Acc:NP_956465]
Human Orthologue:
LSM14B
Human Description:
LSM14B, SCD6 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:15887]
Mouse Orthologue:
Lsm14b
Mouse Description:
LSM14 homolog B (SCD6, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:3040677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45783 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034707 Nonsense 379 380 8 9
ENSDART00000055116   None 145 None 5
Genomic Location (Zv9):
Chromosome 23 (position 581822)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 552813
GRCz11 23 565606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCAGAGGAGCAGCACAGCGCACGCTCACACACAGAGCAGGCAGCGCA[C/T]GAGTGTGAAACACACACCATGAGTGAGTCTGAGTGTGCGCAGAGGTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link