admp

Ensembl ID:
ENSDARG00000025372
ZFIN ID:
ZDB-GENE-011214-1
Description:
anti-dorsalizing morphogenic protein [Source:RefSeq peptide;Acc:NP_571951]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15652 Essential Splice Site Available for shipment Available now
sa33054 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037557 Essential Splice Site 187 391 3 5
Genomic Location (Zv9):
Chromosome 2 (position 54080816)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53765796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCCMATTCACTCTACTGGCTGGGAGGTTTTYACCATCACTCAAGCTG[T/C]AAGCATYAACTAAAGACTTMCTTTCAGACATTTACTAAAATATTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037557 Essential Splice Site 253 391 5 5
Genomic Location (Zv9):
Chromosome 2 (position 54072303)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53757283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTAGCGGGAGCACTTTTCTGACTTCCTCCTCATCTCTTGTTCTCCGCA[G/A]GTTCAGATGTTTCTCCTGGCGGCTCCAGTCAGCCGCTTCCCAGTGTCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link