ENSDARG00000025364

Ensembl ID:
ENSDARG00000025364
Human Orthologue:
ACTN4
Human Description:
actinin, alpha 4 [Source:HGNC Symbol;Acc:166]
Mouse Orthologue:
Actn4
Mouse Description:
actinin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1890773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24820 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032887 Nonsense 384 426 9 9
Genomic Location:
Chromosome Zv9_NA540 (position 870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAGGATCAGCAGTGTTGATGTAATCTCTCCTGTCTATGCAGGTGCAG[C/T]AACTGGTTCCACAGCGTGATCAGGCACTACAGGAGGAACTCACCCGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jkg143a4