ENSDARG00000025364

Ensembl ID:
ENSDARG00000025364
Human Orthologue:
ACTN4
Human Description:
actinin, alpha 4 [Source:HGNC Symbol;Acc:166]
Mouse Orthologue:
Actn4
Mouse Description:
actinin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1890773]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39517 Nonsense Mutation detected in F1 DNA During 2016
sa24820 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032887 Nonsense 206 426 5 9
Genomic Location (Zv9):
Chromosome Zv9_NA540 (position 8012)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150305.1 8012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCATGCTCACACAAAAGGACTATGAAACCGCATCCCTGTCTGAGATT[A/T]AAGCTCTCCTGAAGAAACACGAGGCCTTCGAGAGCGACCTTGCCGCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032887 Nonsense 384 426 9 9
Genomic Location (Zv9):
Chromosome Zv9_NA540 (position 870)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150305.1 870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAGGATCAGCAGTGTTGATGTAATCTCTCCTGTCTATGCAGGTGCAG[C/T]AACTGGTTCCACAGCGTGATCAGGCACTACAGGAGGAACTCACCCGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link