olfcg7

Ensembl ID:
ENSDARG00000025351
ZFIN ID:
ZDB-GENE-081029-5
Description:
Novel odorant receptor protein [Source:UniProtKB/TrEMBL;Acc:B8JIF5]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22448 Nonsense Mutation detected in F1 DNA During 2015
sa28285 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2015
sa13840 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110523 Nonsense 227 675 2 5
ENSDART00000137393 Nonsense 393 842 3 6
Genomic Location:
Chromosome 14 (position 17692703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATGTGCCTGAACACAGATATTCAAGCCATGTTTATAAAGCAATTTA[T/A]GCAGTAGCTCATTCACTACATAGTCTGCTCAAATGCAAGGAAGGAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110523 Splice Site None 675 None 5
ENSDART00000137393 Essential Splice Site 421 842 3 6
Genomic Location:
Chromosome 14 (position 17692788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGGAAGGAGAAGATTGTGAGAAAGGCCACGCAACACAACCACAGCAG[G/A]TTAAATATAAACCACAACCTAATTTTATAATATATATATATATATATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110523 Nonsense 656 675 5 5
ENSDART00000137393 Nonsense 823 842 6 6
Genomic Location:
Chromosome 14 (position 17695092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCTTACTTCTCTGCATATTTGCACCTAAATGTTACATAATCATATG[T/A]AAGCCTGAACAAAATACAAAGCAACATGTCATGGGAAAAACATCTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n9jjq2b0