olfcg7

Ensembl ID:
ENSDARG00000025351
ZFIN ID:
ZDB-GENE-081029-5
Description:
Novel odorant receptor protein [Source:UniProtKB/TrEMBL;Acc:B8JIF5]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22448 Nonsense Mutation detected in F1 DNA During 2014
sa13840 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110523 Nonsense 227 675 2 5
ENSDART00000137393 Nonsense 393 842 3 6
Genomic Location:
Chromosome 14 (position 17692703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATGTGCCTGAACACAGATATTCAAGCCATGTTTATAAAGCAATTTA[T/A]GCAGTAGCTCATTCACTACATAGTCTGCTCAAATGCAAGGAAGGAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110523 Nonsense 656 675 5 5
ENSDART00000137393 Nonsense 823 842 6 6
Genomic Location:
Chromosome 14 (position 17695092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCTTACTTCTCTGCATATTTGCACCTAAATGTTACATAATCATATG[T/A]AAGCCTGAACAAAATACAAAGCAACATGTCATGGGAAAAACATCTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n9jjq2b0