NEK10

Ensembl ID:
ENSDARG00000025335
Description:
NIMA (never in mitosis gene a)- related kinase 10 [Source:HGNC Symbol;Acc:18592]
Human Orthologue:
NEK10
Human Description:
NIMA (never in mitosis gene a)- related kinase 10 [Source:HGNC Symbol;Acc:18592]
Mouse Orthologue:
Nek10
Mouse Description:
NIMA (never in mitosis gene a)- related kinase 10 Gene [Source:MGI Symbol;Acc:MGI:2685128]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42826 Nonsense Mutation detected in F1 DNA During 2017
sa11151 Nonsense Available for shipment Available now
sa22955 Essential Splice Site Available for shipment Available now
sa12878 Nonsense Available for shipment Available now
sa42825 Nonsense Mutation detected in F1 DNA During 2017
sa18477 Essential Splice Site Available for shipment Available now
sa6449 Nonsense Mutation detected in F1 DNA During 2017
sa36262 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001 Nonsense 86 1099 5 40
ENSDART00000123061 Nonsense 86 1150 5 41
Genomic Location (Zv9):
Chromosome 16 (position 53676915)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49946576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCATTTCCTTGTCTAACTAGTGTTTGTTTTGATAACAGCGTGACATA[C/A]AGAAAGCAGAGATATTTCAATGACCAGCCACATCACAGATTATTCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001 Nonsense 340 1099 14 40
ENSDART00000123061 Nonsense 340 1150 13 41
Genomic Location (Zv9):
Chromosome 16 (position 53669356)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49939017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTWAAATTGTACTTTAAATTTTGGCAAACTGYTTTTTTTCCAGAGAA[C/T]GAGTGTATGTGTCCGATCGCTCCACCATTGATTCAATTTCCAGCGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001 Essential Splice Site 385 1099 14 40
ENSDART00000123061 Essential Splice Site 385 1150 13 41
Genomic Location (Zv9):
Chromosome 16 (position 53669219)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49938880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTGTGCGCTCATGAAACAGCGGAGAACACCATCAGTCTGCAGTCAGG[T/C]GAGGAGACTCAGAAAATGTAGGAATTATGAACCTAAAGCCTGTTTTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001 Nonsense 516 1099 19 40
ENSDART00000123061 Nonsense 516 1150 18 41
Genomic Location (Zv9):
Chromosome 16 (position 53665809)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49935470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAAACCAGAACCGTCCTCCTATAAGAGTGGTCAATGGTTATGCGGTTT[T/A]GGAGCATCTAGGMAGCGGAGCTTTTGGCAGCGTCTTTAAGGTCAAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001 Nonsense 576 1099 21 40
ENSDART00000123061 Nonsense 576 1150 20 41
Genomic Location (Zv9):
Chromosome 16 (position 53663826)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49933487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACCTCCATCTCTGTCCACACAATCTTCAAAAAATATGTCTTTTTTTT[C/T]AGATGTCTCATCCGAACATTGTAAAATACTTCAAAACATTTTTAGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001 Essential Splice Site 759 1099 26 40
ENSDART00000123061 Essential Splice Site 759 1150 25 41
Genomic Location (Zv9):
Chromosome 16 (position 53652874)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49922535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAGAAGACAAAACCTTCKCCGAAAGAGTAACCGACATGATTAAATGG[T/A]AGGATTCCCTGAAAACTGCTTTCNNNNNNNAGATATAAACACATGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001   None 1099 None 40
ENSDART00000123061 Nonsense 825 1150 26 41
Genomic Location (Zv9):
Chromosome 16 (position 53650751)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49920412
KASP Assay ID:
554-4639.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGTACTTYCTGGAGAGCAACAGGACTAGAATGTGTGGCCCGATACAA[C/T]AGGTTTGAAAATTCTCKACTTCTGAATGAAGCARAAAKGATTTATTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029001 Essential Splice Site 855 1099 29 40
ENSDART00000123061 Essential Splice Site 928 1150 30 41
Genomic Location (Zv9):
Chromosome 16 (position 53648439)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49918100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTCCACATCAGTTTTAGTAGTTGGAGGAGAACAAAAGCAGAGTCAAG[G/A]TAACAACTTACACCTGATACATGCAATCTTAATAAATCACAATCTAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link