rbm28

Ensembl ID:
ENSDARG00000025332
ZFIN ID:
ZDB-GENE-040426-960
Description:
RNA-binding protein 28 [Source:RefSeq peptide;Acc:NP_956615]
Human Orthologue:
RBM28
Human Description:
RNA binding motif protein 28 [Source:HGNC Symbol;Acc:21863]
Mouse Orthologue:
Rbm28
Mouse Description:
RNA binding motif protein 28 Gene [Source:MGI Symbol;Acc:MGI:2655711]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28988 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43056 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31022 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034817 Essential Splice Site 134 856 3 23
ENSDART00000125587 Essential Splice Site 134 850 3 24
Genomic Location (Zv9):
Chromosome 18 (position 10158193)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10741439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAGAAAAAAGAAAACGGTTGGCTGATCATCAGAAATCTAAGTTTTAAG[G/A]TGATGTTATACATAATATAAAGGAACAATGCTTAGTTTTGACTTTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034817 Essential Splice Site 496 856 15 23
ENSDART00000125587 Essential Splice Site 490 850 16 24
ENSDART00000034817 Essential Splice Site 496 856 15 23
ENSDART00000125587 Essential Splice Site 490 850 16 24
Genomic Location (Zv9):
Chromosome 18 (position 10151894)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10735140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGAAGCTGCAGAGAAATGTATCGCTGCTGCTCTAGATGAAAAAGAG[G/A]TTATACAATCCTCCTTTTTATCTAAATTTTTATCATTACTAGTAAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034817 Essential Splice Site 496 856 15 23
ENSDART00000125587 Essential Splice Site 490 850 16 24
ENSDART00000034817 Essential Splice Site 496 856 15 23
ENSDART00000125587 Essential Splice Site 490 850 16 24
Genomic Location (Zv9):
Chromosome 18 (position 10151894)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10735140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGAAGCTGCAGAGAAATGTATCGCTGCTGCTCTAGATGAAAAAGAG[G/A]TTATACAATCCTCCTTTTTATCTAAATTTTTATCATTACTAGTAAACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link