fynb

Ensembl ID:
ENSDARG00000025319
ZFIN ID:
ZDB-GENE-050706-89
Description:
tyrosine-protein kinase Fyn [Source:RefSeq peptide;Acc:NP_001025140]
Human Orthologue:
FYN
Human Description:
FYN oncogene related to SRC, FGR, YES [Source:HGNC Symbol;Acc:4037]
Mouse Orthologue:
Fyn
Mouse Description:
Fyn proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:95602]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18008 Essential Splice Site Available for shipment Available now
sa17760 Nonsense Available for shipment Available now
sa3055 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036635 Essential Splice Site 155 544 6 14
Genomic Location:
Chromosome 20 (position 397031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTCCCAGCAACTATGTCGCCCCAGTGGACTCAATCCAGGCTGAAGAG[T/C]AAGNNNNNNNTCTGTGTGTCTGAAATMAGTGWGTGAACAGYGTGTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036635 Nonsense 229 544 8 14
Genomic Location:
Chromosome 20 (position 400366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGCAAACTGGACAGTGGAGGCTACTACATMACCACTAGAGCTCAGTTY[G/T]AGACCCTTCAGCAGCTGGTCCAGCATTACACCGGTANNNNNNNNNNNNNNNNNNACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3055
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036635 Nonsense 361 544 11 14
ENSDART00000036635 Nonsense 361 544 11 14
Genomic Location:
Chromosome 20 (position 411853)
KASP Assay ID:
554-2632.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGCTAACATGTGAATGTGGCGYGTTTCAGGCAGTCTCCTAGATTTCT[T/A]GAWGGACGGAGAGGGACGAGCGCTGAAACTGCCCAACCTGGTGGACATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jt83l91z