tcerg1a

Ensembl ID:
ENSDARG00000025314
ZFIN ID:
ZDB-GENE-030131-1791
Description:
transcription elongation regulator 1 [Source:RefSeq peptide;Acc:NP_938171]
Human Orthologue:
TCERG1
Human Description:
transcription elongation regulator 1 [Source:HGNC Symbol;Acc:15630]
Mouse Orthologue:
Tcerg1
Mouse Description:
transcription elongation regulator 1 (CA150) Gene [Source:MGI Symbol;Acc:MGI:1926421]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22557 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105466 Essential Splice Site 646 999 13 22
ENSDART00000131841 Essential Splice Site 675 1049 14 21
ENSDART00000137685 Essential Splice Site 646 812 13 20
ENSDART00000141733 Essential Splice Site 646 1020 13 20
Genomic Location:
Chromosome 14 (position 53474710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGGATGACTTCAGGAAAATGATGGAGGAATCGAAACTGGGTGTCAGG[T/C]GAACACTGAGAGCTCATTTAATGCTGCTGAATGAGTGTCTGTGATGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9aqxhbsj