LOC555913

Ensembl ID:
ENSDARG00000025311
Mouse Orthologue:
Dmbt1
Mouse Description:
deleted in malignant brain tumors 1 Gene [Source:MGI Symbol;Acc:MGI:106210]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23057 Essential Splice Site Available for shipment Available now
sa23056 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8765 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028591 Essential Splice Site 28 487 1 7
Genomic Location:
Chromosome 17 (position 21692214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAACACAACCGTTTCACTGACCTTCAACGATGTTGAGTACGACACTAT[T/G]TGAACAATTTTAGAACTGAGGCTCTATAGTAAAAAATGTGTTGAATGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028591 Essential Splice Site 28 487 2 7
Genomic Location:
Chromosome 17 (position 21692104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAAAAAAAAAAACAACAATATGGTTTGTCTCTCCTTTCCGTTTGCT[A/G]GTTTGGAAACATGCTGCGATTACATCAGAGTGTATGATGGTCCTTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028591 Nonsense 187 487 4 7
Genomic Location:
Chromosome 17 (position 21690445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRAAKGTCTGCTTCAAYGACACCACACATCAGGCATTTCACTCTWCTTCA[C/T]GWTACTTGACTGTTGTCTTCASGAGTGACTTTTCTGGTGTTRGCCATGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xq6kjkjp