dpf3

Ensembl ID:
ENSDARG00000025309
ZFIN ID:
ZDB-GENE-041014-190
Description:
Zinc finger protein DPF3 [Source:UniProtKB/Swiss-Prot;Acc:A9LMC0]
Human Orthologue:
DPF3
Human Description:
D4, zinc and double PHD fingers, family 3 [Source:HGNC Symbol;Acc:17427]
Mouse Orthologue:
Dpf3
Mouse Description:
D4, zinc and double PHD fingers, family 3 Gene [Source:MGI Symbol;Acc:MGI:1917377]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11991 Splice Site, Nonsense Available for shipment Available now
sa8788 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034245 Splice Site, Nonsense 253 381 8 11
ENSDART00000123387 Splice Site, Nonsense 263 391 9 13
Genomic Location (Zv9):
Chromosome 20 (position 28514967)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28586180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTTGTTCTATGACCCTAATCCTTTAATTTGCCCTATTTTTACAGCA[C/T]AGAAAGCGCCTGATGGTTCGATCATCCCTAATGACTACTGTGACTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034245 Nonsense 379 381 11 11
ENSDART00000123387 Nonsense 389 391 12 13
Genomic Location (Zv9):
Chromosome 20 (position 28527181)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28598394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTTGTCATCTGTGCCAGAATCTGCTTAAGGATAAAGCGTCTGGTGTT[G/T]AAGATCCATAAGCATYGTGAGGAGGTTCTGCACACAGAGACGCACAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link