dixdc1a

Ensembl ID:
ENSDARG00000025302
ZFIN ID:
ZDB-GENE-030721-2
Description:
Dixin-A [Source:UniProtKB/Swiss-Prot;Acc:Q804T6]
Human Orthologue:
DIXDC1
Human Description:
DIX domain containing 1 [Source:HGNC Symbol;Acc:23695]
Mouse Orthologue:
Dixdc1
Mouse Description:
DIX domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2679721]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35851 Essential Splice Site Available for shipment Available now
sa12284 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034324 Essential Splice Site 213 443 8 15
ENSDART00000078723 Essential Splice Site 213 443 8 15

The following transcripts of ENSDARG00000025302 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 17090371)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18210744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAGAAAGAAAGCTGAGTGAACGGAATAGACTGCTGAGCGAATACAAA[G/A]TAGGAGAATTCCTCCTTGAATATGCTTAGTGCTAGAAACATGTTTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034324 Nonsense 401 443 14 15
ENSDART00000078723 Nonsense 401 443 14 15

The following transcripts of ENSDARG00000025302 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 17095775)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18216148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTGCAGGACTTCAAGGCGGCTGTGGATCGACATGGCAGTTTCAGATA[T/A]CACTTCAAATCTCTGGATCCAGAGTTCGGAAYGGTGAAAGAAGAGGTKAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link