gfap

Ensembl ID:
ENSDARG00000025301
ZFIN ID:
ZDB-GENE-990914-3
Description:
Glial fibrillary acidic protein [Source:UniProtKB/Swiss-Prot;Acc:Q58EE9]
Human Orthologue:
GFAP
Human Description:
glial fibrillary acidic protein [Source:HGNC Symbol;Acc:4235]
Mouse Orthologue:
Gfap
Mouse Description:
glial fibrillary acidic protein Gene [Source:MGI Symbol;Acc:MGI:95697]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20045 Nonsense Available for shipment Available now
sa33210 Nonsense Mutation detected in F1 DNA During 2017
sa2123 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa20045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028270 Nonsense 128 444 1 9
Genomic Location (Zv9):
Chromosome 3 (position 31941058)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31672368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGAACCAGCTGAGGGGGAAAGAGCCCAGCCGTCTGGGGGACATCTA[T/A]CAGGAGGAGCTGCGGGAGCTGCGCAGACAGGTGGATGGACTCAATGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028270 Nonsense 165 444 1 9
Genomic Location (Zv9):
Chromosome 3 (position 31940949)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31672259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGAGATTGAGAGAGACAACTTGGCCTCAGACCTCGGCACTCTCAAA[C/T]AGAGGTAAGGACTGAGGTGATGCACAGTGTTGGGTATGTTACTTTCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2123
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028270 Nonsense 243 444 4 9
Genomic Location (Zv9):
Chromosome 3 (position 31935545)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31666855
KASP Assay ID:
554-3307.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGATGGCCCAACAGGTTCATGTGGATCTGGATGTGTCTAAGCCAGACT[T/A]GACCGCTGCGCTGAAGGAGATCAGAKCTCAGTTTGAGGCCATGGCCAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link