tspan9

Ensembl ID:
ENSDARG00000025299
ZFIN ID:
ZDB-GENE-060503-632
Description:
Novel protein similar to vertebrate Tetraspanin family [Source:UniProtKB/TrEMBL;Acc:Q1LXC5]
Human Orthologue:
TSPAN9
Human Description:
tetraspanin 9 [Source:HGNC Symbol;Acc:21640]
Mouse Orthologue:
Tspan9
Mouse Description:
tetraspanin 9 Gene [Source:MGI Symbol;Acc:MGI:1924558]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23241 Nonsense Mutation detected in F1 DNA During 2014
sa4029 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6503 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Nonsense 40 241 2 7
ENSDART00000146692 Nonsense 26 227 1 6
Genomic Location:
Chromosome 18 (position 10508510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTGTGGCTGTGGGCTGCTGGGAGTTGGAATCTGGCTGTCTGTTTCT[C/T]AAGGCAGCTTCGCCACCTTCTCCCCCTCCTTCCCCTCTCTCTCCGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Essential Splice Site 219 241 None 7
ENSDART00000146692 Essential Splice Site 205 227 None 6
Genomic Location:
Chromosome 18 (position 10464312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATGCAGTATATGTCATGTTAACCTTTCTCCTGAATTTTGTCATTTC[A/G]GCTCCTGGGAATGGCCTTTTCCATGACACTGTTCCATCAGATCCACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Essential Splice Site 219 241 7 7
ENSDART00000146692 Essential Splice Site 205 227 6 6
Genomic Location:
Chromosome 18 (position 10464311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATGCAGTATATGTCATGTTAACCTTTCTCCTGAATTTTGTCATTTCR[G/T]CTCCTGGGAATGGCCTTTTCCATGACACTGTTCCATCAGATCCACAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ev54aph6