tspan9

Ensembl ID:
ENSDARG00000025299
ZFIN ID:
ZDB-GENE-060503-632
Description:
Novel protein similar to vertebrate Tetraspanin family [Source:UniProtKB/TrEMBL;Acc:Q1LXC5]
Human Orthologue:
TSPAN9
Human Description:
tetraspanin 9 [Source:HGNC Symbol;Acc:21640]
Mouse Orthologue:
Tspan9
Mouse Description:
tetraspanin 9 Gene [Source:MGI Symbol;Acc:MGI:1924558]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39192 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23241 Nonsense Mutation detected in F1 DNA During 2016
sa6503 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Essential Splice Site 7 241 2 7
ENSDART00000146692   None 227 None 6
Genomic Location (Zv9):
Chromosome 18 (position 10508608)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11091854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTTATTGTCCATCTGGTATCTGTGGCACATATTGAATGTAGTTGTACA[G/T]ATGTTCCAGAACGCATCAGTATCTGATAATCTGTTCTTTCTGTCTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Nonsense 40 241 2 7
ENSDART00000146692 Nonsense 26 227 1 6
Genomic Location (Zv9):
Chromosome 18 (position 10508510)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11091756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTGTGGCTGTGGGCTGCTGGGAGTTGGAATCTGGCTGTCTGTTTCT[C/T]AAGGCAGCTTCGCCACCTTCTCCCCCTCCTTCCCCTCTCTCTCCGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Essential Splice Site 219 241 7 7
ENSDART00000146692 Essential Splice Site 205 227 6 6
Genomic Location (Zv9):
Chromosome 18 (position 10464311)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11047557
KASP Assay ID:
554-4236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATGCAGTATATGTCATGTTAACCTTTCTCCTGAATTTTGTCATTTCR[G/T]CTCCTGGGAATGGCCTTTTCCATGACACTGTTCCATCAGATCCACAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link