gbgt1l1

Ensembl ID:
ENSDARG00000025275
ZFIN ID:
ZDB-GENE-040426-1117
Description:
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1, like 1 [Source:RefSeq peptide;Acc:NP_95662
Mouse Orthologue:
Abo
Mouse Description:
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14016 Nonsense Available for shipment Available now
sa33587 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019992 Nonsense 32 316 3 6
ENSDART00000139020 Nonsense 32 316 2 5

The following transcripts of ENSDARG00000025275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 25381857)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23209122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTATGTTTTGTTTTTCAGGCTGATTTTYTTTGGCTACACCACTATATG[G/A]TTCAGGTAAGAAGACCATCTATATACATAATTCTTGTTTATGTGGATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019992 Nonsense 274 316 6 6
ENSDART00000139020 Nonsense 274 316 5 5

The following transcripts of ENSDARG00000025275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 25371979)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23199244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAGGCAATATGGCATGAGGAGTCTCACTTGAACAAGTATTTCCTTTA[C/A]AACAAACCCACTAAGCTGCTGTCACCTGAGTATCTGTGGCGGGACATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link