pdcd6ip

Ensembl ID:
ENSDARG00000025269
ZFIN ID:
ZDB-GENE-040426-2678
Description:
programmed cell death 6 interacting protein [Source:RefSeq peptide;Acc:NP_998525]
Human Orthologues:
AC011767.1, AC055876.3, PDCD6IP
Human Description:
programmed cell death 6 interacting protein [Source:HGNC Symbol;Acc:8766]
Mouse Orthologue:
Pdcd6ip
Mouse Description:
programmed cell death 6 interacting protein Gene [Source:MGI Symbol;Acc:MGI:1333753]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5928 Nonsense Mutation detected in F1 DNA During 2017
sa43338 Nonsense Mutation detected in F1 DNA During 2017
sa9404 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028592 Nonsense 576 873 13 18
ENSDART00000122296   None 465 None 12
ENSDART00000135164 Nonsense 569 866 13 18
Genomic Location (Zv9):
Chromosome 19 (position 44471185)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43298953
KASP Assay ID:
554-3779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGCGCAACTGGATGAGGTCAAGAGGGAACGAGAAGTTCTGGAAGGA[G/T]AGGTGAAGTCAGTGACCTTTGACCTGACGGCAAAGTTTCTTACAGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028592 Nonsense 799 873 17 18
ENSDART00000122296   None 465 None 12
ENSDART00000135164 Nonsense 792 866 17 18
Genomic Location (Zv9):
Chromosome 19 (position 44475284)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43303052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCCCCAATGGCTCCCGGCAGCTCTAATCCTCCACCTGTTGCACCCACT[G/T]GACCCTCACAGGCTCAAGGGCCACCATACCCCAGTTATCAAGGCTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028592 Nonsense 839 873 18 18
ENSDART00000122296   None 465 None 12
ENSDART00000135164 Nonsense 832 866 18 18
Genomic Location (Zv9):
Chromosome 19 (position 44476418)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43304186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCYTATAATCCCTATGCATACGGGCAGTATAATATGCCCTACATGCCCTA[T/A]CAAGCTCAGGGCCAGGCTGGATACCCTGGAGCCCCTGCAAYACAGCAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link