epc1

Ensembl ID:
ENSDARG00000025241
ZFIN ID:
ZDB-GENE-070629-5
Human Orthologue:
EPC1
Human Description:
enhancer of polycomb homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19876]
Mouse Orthologue:
Epc1
Mouse Description:
enhancer of polycomb homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1278322]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38904 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44775 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033072 Essential Splice Site 404 796 8 14
Genomic Location (Zv9):
Chromosome 12 (position 43382576)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 40963764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGGAGCGTTTGCCTTCAGGCGGAAAGCAGGATGTGTTTATCACGCT[G/A]TAGGTGTCCAGACCTGACCTCATATCTCATACCTTGTTCTTCCTCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033072 Essential Splice Site 773 796 13 14
Genomic Location (Zv9):
Chromosome 12 (position 43373602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGAAGCTTGCCGCAAGCAACTGTCAGCTTCCCAAAGCCAACGCTGGG[T/A]AACCTTTATTTATTTATTTTTTATCACATTTTCTCATAGTTAGCACACCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link