myo5ab

Ensembl ID:
ENSDARG00000025218
ZFIN ID:
ZDB-GENE-050411-72
Human Orthologue:
MYO5A
Human Description:
myosin VA (heavy chain 12, myoxin) [Source:HGNC Symbol;Acc:7602]
Mouse Orthologue:
Myo5a
Mouse Description:
myosin VA Gene [Source:MGI Symbol;Acc:MGI:105976]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32515 Nonsense Mutation detected in F1 DNA During 2016
sa24605 Essential Splice Site Available for shipment Available now
sa32514 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44232 Nonsense Mutation detected in F1 DNA During 2016
sa9541 Nonsense Available for shipment Available now
sa38002 Nonsense Mutation detected in F1 DNA During 2016
sa24604 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44231 Nonsense Mutation detected in F1 DNA During 2016
sa3305 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa32515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Nonsense 31 1395 2 32
Genomic Location (Zv9):
Chromosome 25 (position 7913055)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7525579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCCAGACCCTGCAGAGGTGTGGAGATCAGCAGAGCTCAGCAGAGACTA[C/A]AGACCTGGAGATCCTGTCCTGCATCTACTGCTGGAGGATGAGACGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Essential Splice Site 279 1395 7 32
Genomic Location (Zv9):
Chromosome 25 (position 7903622)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7466060
GRCz10 25 7516146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTCTGTGCCTGCGCTCATTTACCTGAATTTAAACCTCTAAAGTTAG[G/A]TAAGTGCGCAGTCTACAGTGTGCGTCTTTATTTGACTGATTACAGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Essential Splice Site 315 1395 8 32
Genomic Location (Zv9):
Chromosome 25 (position 7903355)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7465793
GRCz10 25 7515879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGACCTGAAGGAGATGCAGGCCACAAGGAAAGCCTTTTCACTGCTGG[G/A]TATGAATCGTTTTAGATTTTCATCTCACTTGTGGGGTTTTGTAATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Nonsense 322 1395 9 32
Genomic Location (Zv9):
Chromosome 25 (position 7901797)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7514321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCACAAACATGCAAGTATCTGCTGATTCCAGGAATTACCGAGGCACAC[C/T]AAATGGGTTTATTCCAAATCCTGTCAGCCATTCTTCATCTGGGGAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Nonsense 393 1395 10 32
Genomic Location (Zv9):
Chromosome 25 (position 7901509)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7463947
GRCz10 25 7514033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYCATAAAAAGCTGAAAACGGCCACGGAAACCCTWAATAAACCTGTRACC[C/T]GACTGGAAGCTGTGAACGGTCGRGACGCTCTTGCAAAGCACATTTACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Nonsense 823 1395 20 32
Genomic Location (Zv9):
Chromosome 25 (position 7893955)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7456393
GRCz10 25 7506479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGGCCACCGTCGTCTTCCAGAAGAACACGCGCATGTGGGCTGCAAGA[C/T]GACAGTACCTGAGGCAGAAAACGGCAGCGGTGCTCATTCAGAGGATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Essential Splice Site 930 1395 21 32
Genomic Location (Zv9):
Chromosome 25 (position 7891213)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7453651
GRCz10 25 7503737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCATGGAAAACAAGATCATGCAGCTGCAGAGGAAACTAGATGAGCAG[G/A]TCTCCTTTTTTCCATTTTGGAGTTTGTACTGATTTCTAAAGAGGAGTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Nonsense 1222 1395 28 32
Genomic Location (Zv9):
Chromosome 25 (position 7885560)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7448099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAAAGGTGACGTCCCCTGGAGGTCGGGCATATAATGTGATCCTGGAG[C/T]AGCTCAACTCCACCAATGAGGAGCTGGAGGTGCGGAAGGAGGAAGTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3305
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058337 Nonsense 1241 1395 28 32
Genomic Location (Zv9):
Chromosome 25 (position 7885503)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7448042
KASP Assay ID:
554-3026.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCACCAATGAGGAGCTGGAGGTGCGGAAGGAGGAAGTGCTCATTTTA[C/T]GATCTCAACTAGTCAGCCATGAGGCCTTCAAACACAAGGTATTATGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link