ppox

Ensembl ID:
ENSDARG00000025200
ZFIN IDs:
ZDB-GENE-051120-90, ZDB-GENE-051120-90
Description:
protoporphyrinogen oxidase [Source:RefSeq peptide;Acc:NP_001035068]
Human Orthologue:
PPOX
Human Description:
protoporphyrinogen oxidase [Source:HGNC Symbol;Acc:9280]
Mouse Orthologue:
Ppox
Mouse Description:
protoporphyrinogen oxidase Gene [Source:MGI Symbol;Acc:MGI:104968]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6443 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030714 Essential Splice Site 419 477 11 13
ENSDART00000130819 Essential Splice Site 419 477 10 12
Genomic Location (Zv9):
Chromosome 16 (position 45063378)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42342517
KASP Assay ID:
554-4552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGAGCGTAACCTCACAGCCTGTTTGGAGCTGCGTTGCTTTACTAAAG[G/A]TGAGACTGTGTGCTGAAATAAAGCAAATACAATTTTTAATCATCATRACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link