LOC100332028

Ensembl ID:
ENSDARG00000025189
Human Orthologue:
CPNE8
Human Description:
copine VIII [Source:HGNC Symbol;Acc:23498]
Mouse Orthologue:
Cpne8
Mouse Description:
copine VIII Gene [Source:MGI Symbol;Acc:MGI:1914121]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4306 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034737 Nonsense 428 575 17 20
Genomic Location:
Chromosome 25 (position 36949152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCTTCTACGAGGACATGATGTGATCAGATTTGGTCTTTGCAGATA[T/A]GCCTCTTTAGTGAAGGATGGTTCAGAATACTTCATCCTCCTCATCATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/da1uxw3z