MPP7 (3 of 3)

Ensembl ID:
ENSDARG00000025168
Description:
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) [Source:HGNC Symbol;Acc:26542]
Human Orthologue:
MPP7
Human Description:
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) [Source:HGNC Symbol;Acc:26542]
Mouse Orthologue:
Mpp7
Mouse Description:
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1890 Nonsense F2 line generated During 2014
sa5121 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1890
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081897 Nonsense 113 161 4 5
ENSDART00000081899 Nonsense 113 313 4 9
Genomic Location:
Chromosome 2 (position 4369330)
KASP Assay ID:
554-1880.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGTTATSCTTTTCAGACTCTTCTGTTAGTGCATGATGTGGTGGCG[C/T]AGAAAAGGTTTGACCCTCRGTTGCCGCCTCTGCCCCCTTTACCTGATTRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081897 None None 161 None 5
ENSDART00000081899 Essential Splice Site 150 313 5 9
Genomic Location:
Chromosome 2 (position 4375623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTATCTCTGAATGACAGCTTGAAGAACATCAGCAAACGTGTGTTTTGC[A/T]GGGAGCCACCATAAARARAGACGAGTCGTCTGGAGCTATAATYGYGGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7yhemqjp