accn4a

Ensembl ID:
ENSDARG00000025162
ZFIN ID:
ZDB-GENE-040513-5
Description:
Amiloride-sensitive cation channel 4-A [Source:UniProtKB/Swiss-Prot;Acc:Q708S4]
Human Orthologue:
ACCN4
Human Description:
amiloride-sensitive cation channel 4, pituitary [Source:HGNC Symbol;Acc:21263]
Mouse Orthologue:
Accn4
Mouse Description:
amiloride-sensitive cation channel 4, pituitary Gene [Source:MGI Symbol;Acc:MGI:2652846]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7173 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032695 Nonsense 201 539 2 10
ENSDART00000137835 None None 192 None 1
Genomic Location:
Chromosome 9 (position 11478810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCCTTTATTTTTTCCTCACAGGTCTAYACAAGATATGGAAAATGCTA[T/A]ACTTTCAATGGAAACAAGACAACCTCCAGGRAGACAAAGCAAGGTGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yh8h4jyh