cd63

Ensembl ID:
ENSDARG00000025147
ZFIN ID:
ZDB-GENE-030131-180
Description:
CD63 antigen [Source:RefSeq peptide;Acc:NP_955837]
Human Orthologue:
CD63
Human Description:
CD63 molecule [Source:HGNC Symbol;Acc:1692]
Mouse Orthologue:
Cd63
Mouse Description:
CD63 antigen Gene [Source:MGI Symbol;Acc:MGI:99529]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5806 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5806
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031047 Nonsense 187 237 6 8
Genomic Location:
Chromosome 23 (position 32320704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAAGAACTGTGGTATTGGAGCTATGAYGAAACCCACCGTAATCTACW[T/A]AGAGGTAAGATTGTTTTTCTGTCTTATTGATGCATATTAGTAAGAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gvh4wxol