lbx2

Ensembl ID:
ENSDARG00000025131
ZFIN ID:
ZDB-GENE-001206-2
Description:
lady bird-like homeobox 1 homolog [Source:RefSeq peptide;Acc:NP_001007135]
Human Orthologue:
LBX1
Human Description:
ladybird homeobox 1 [Source:HGNC Symbol;Acc:16960]
Mouse Orthologue:
Lbx1
Mouse Description:
ladybird homeobox homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104867]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa605 Essential Splice Site F2 line generated During 2014
hu3336 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa605
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031508 Essential Splice Site 109 257 1 2
Genomic Location:
Chromosome 14 (position 5392662)
KASP Assay ID:
554-0515.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAAAACATTTAAGGGTTTGGAAGTCAGCGTTATACAAGCAGCAGAAG[G/A]TAAAAAGTTCATAATTATTAACGAATTATCGCACTTGTTTTCAATGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031508 Nonsense 239 257 2 2
Genomic Location:
Chromosome 14 (position 5394379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCCCAGTCTTTCCCCAAGAGCCTTTCCACAGTCCCCATCCTCGTCC[A/T]GAGGCCAAACCACAGACGAGTTCTCAGAGGAGGACGAGGAAATCGAGGTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Scoliosis: A genome-wide association study identifies common variants near LBX1 associated with adolescent idiopathic scoliosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f8nit1jt