edem1

Ensembl ID:
ENSDARG00000025094
ZFIN ID:
ZDB-GENE-040426-808
Description:
ER degradation-enhancing alpha-mannosidase-like 1 [Source:RefSeq peptide;Acc:NP_957483]
Human Orthologue:
EDEM1
Human Description:
ER degradation enhancer, mannosidase alpha-like 1 [Source:HGNC Symbol;Acc:18967]
Mouse Orthologue:
Edem1
Mouse Description:
ER degradation enhancer, mannosidase alpha-like 1 Gene [Source:MGI Symbol;Acc:MGI:2180139]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7046 Nonsense Mutation detected in F1 DNA During 2014
sa7587 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003298 Nonsense 100 523 1 13
ENSDART00000088961 Nonsense 103 646 1 14
ENSDART00000147208 Nonsense 100 628 1 12
Genomic Location:
Chromosome 6 (position 42880211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCCMAAGAAGTCCTACCTCAGTTTCTTTGAGGAGGGCAGAGATGAGTA[T/A]GACAGAAAGTACAGCTCTTTCCCGGACGCCCTYAAAGTCAAGATGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003298 Missense 122 523 1 13
ENSDART00000088961 Missense 125 646 1 14
ENSDART00000147208 Missense 122 628 1 12
Genomic Location:
Chromosome 6 (position 42880146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTCCCGGACGCCCTYAAAGTCAAGATGAGGGCCATGGCGCGGGACA[T/A]GTTTTATTTCGGATATGATAAYTACATGAAGTTTGCCTTTCCAGAGGAWG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ylgzszbw