edem1

Ensembl ID:
ENSDARG00000025094
ZFIN ID:
ZDB-GENE-040426-808
Description:
ER degradation-enhancing alpha-mannosidase-like 1 [Source:RefSeq peptide;Acc:NP_957483]
Human Orthologue:
EDEM1
Human Description:
ER degradation enhancer, mannosidase alpha-like 1 [Source:HGNC Symbol;Acc:18967]
Mouse Orthologue:
Edem1
Mouse Description:
ER degradation enhancer, mannosidase alpha-like 1 Gene [Source:MGI Symbol;Acc:MGI:2180139]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7046 Nonsense Mutation detected in F1 DNA During 2016
sa7587 Missense Mutation detected in F1 DNA During 2016
sa31536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003298 Nonsense 100 523 1 13
ENSDART00000088961 Nonsense 103 646 1 14
ENSDART00000147208 Nonsense 100 628 1 12
Genomic Location (Zv9):
Chromosome 6 (position 42880211)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42951265
KASP Assay ID:
554-4920.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCCMAAGAAGTCCTACCTCAGTTTCTTTGAGGAGGGCAGAGATGAGTA[T/A]GACAGAAAGTACAGCTCTTTCCCGGACGCCCTYAAAGTCAAGATGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003298 Missense 122 523 1 13
ENSDART00000088961 Missense 125 646 1 14
ENSDART00000147208 Missense 122 628 1 12
Genomic Location (Zv9):
Chromosome 6 (position 42880146)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42951200
KASP Assay ID:
554-4305.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTCCCGGACGCCCTYAAAGTCAAGATGAGGGCCATGGCGCGGGACA[T/A]GTTTTATTTCGGATATGATAAYTACATGAAGTTTGCCTTTCCAGAGGAWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003298   None 523 13 13
ENSDART00000088961 Nonsense 623 646 14 14
ENSDART00000147208 Nonsense 605 628 12 12
Genomic Location (Zv9):
Chromosome 6 (position 42865635)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42936689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGTTTTTGACAAATGTTTATTTGTGCAATAGTGTGACCGGATTCCT[G/T]AAGAGAGACGTTATGGTCTTCCACTAAAGAGCATGTACATGAGGCAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link