ezr

Ensembl ID:
ENSDARG00000025091
ZFIN ID:
ZDB-GENE-050803-1
Description:
villin 2 [Source:RefSeq peptide;Acc:NP_001025456]
Human Orthologue:
EZR
Human Description:
ezrin [Source:HGNC Symbol;Acc:12691]
Mouse Orthologue:
Ezr
Mouse Description:
ezrin Gene [Source:MGI Symbol;Acc:MGI:98931]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23649 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa14485 Essential Splice Site Available for shipment Available now
sa14899 Nonsense Available for shipment Available now
sa6621 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078893 Essential Splice Site 64 583 None 14
ENSDART00000123177 Essential Splice Site 64 583 None 13
ENSDART00000124955 Missense 65 585 3 18

The following transcripts of ENSDARG00000025091 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13516478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATGGACAGCAAAGGCTACCTTACATGGCTGAAACTTGACAAAAAGG[T/A]AATTGTACAATTTTTTTTAACAACCGATTGTCAATGCTAATATTATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078893 Essential Splice Site 184 583 6 14
ENSDART00000123177 Essential Splice Site 184 583 5 13
ENSDART00000124955 Essential Splice Site 184 585 6 18

The following transcripts of ENSDARG00000025091 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13508224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGGAGAGGATTCAGGTGTGGCACGARGAACATCGKGGGATGCTCAGG[T/C]AAATTTGACATTTACTGTAGTCATTTGGGATGTACAATATTAGATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078893 Nonsense 191 583 7 14
ENSDART00000123177 Nonsense 191 583 6 13
ENSDART00000124955 Nonsense 191 585 7 18

The following transcripts of ENSDARG00000025091 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13505619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGATTGATGTTGTATTTGTGTTCCTAGAGAGGACGCAATGCTGGAGTA[T/A]TTGAAAATCGCTCAGGATCTGGAAATGTACGGCGTGAACTATTTTGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078893 Nonsense 539 583 14 14
ENSDART00000123177 Nonsense 539 583 13 13
ENSDART00000124955 Nonsense 541 585 18 18

The following transcripts of ENSDARG00000025091 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 13483830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCAYGTTTTCTCCTTCACAGGCTCTGACCTCAGAATTGGCCCAAGCT[C/T]GAGACGACACCAAGAAGACTCAGAACGACCTGCTGCACACAGAGAACGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0znt1n6v