loxl4

Ensembl ID:
ENSDARG00000025089
ZFIN ID:
ZDB-GENE-080722-19
Description:
Novel protein similar to H.sapiens LOXL4, lysyl oxidase-like 4 (LOXL4) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
LOXL4
Human Description:
lysyl oxidase-like 4 [Source:HGNC Symbol;Acc:17171]
Mouse Orthologue:
Loxl4
Mouse Description:
lysyl oxidase-like 4 Gene [Source:MGI Symbol;Acc:MGI:1914823]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1838 Nonsense Available for shipment Available now
sa16021 Essential Splice Site Available for shipment Available now
sa6327 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10091 Essential Splice Site Available for shipment Available now
sa3874 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044963 None None 836 None 17
ENSDART00000134411 Nonsense 16 280 1 3
ENSDART00000145635 None None 336 None 7
Genomic Location:
Chromosome 13 (position 40584762)
KASP Assay ID:
554-1829.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCAGAGCCTCATCGGTGTGCAGTCATGATTCGGGTCWGTCCGCTGTG[T/A]ATTCTTTTSTTTGCGCTGCTCTTCATGTGTATGGACGCTCGTCCTGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044963 Essential Splice Site 201 836 4 17
ENSDART00000134411 None None 280 None 3
ENSDART00000145635 None None 336 None 7
Genomic Location:
Chromosome 13 (position 40578902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGTCAGATTAATCAGCAYTTCARGTATTTTKTTTAGGGAGAAATGGA[C/T]GTATTTCAACARGAMAAGTACTGAGTGCGGAAGATGAGGATACAAGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044963 Essential Splice Site 201 836 4 17
ENSDART00000134411 None None 280 None 3
ENSDART00000145635 None None 336 None 7
Genomic Location:
Chromosome 13 (position 40578902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGTCAGATTAATCAGCATTTCAGGTATTTTTTTTAGGGAGAAATGGA[C/A]GTATTTCAACARGACAAGTACTGAGTGCGGAAGATGAGGATACAAGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044963 Essential Splice Site 692 836 13 17
ENSDART00000134411 None None 280 None 3
ENSDART00000145635 Essential Splice Site 192 336 3 7
Genomic Location:
Chromosome 13 (position 40543087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCGGCCAYGGGCTTCAAGRGAGTCCTGGACCTGGCATCAGTGCCACAG[G/A]TGAGGGGCTGTATATATCACATGACAGCATGAATAGCCCATARCAGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044963 Essential Splice Site 731 836 15 17
ENSDART00000134411 None None 280 None 3
ENSDART00000145635 Essential Splice Site 231 336 5 7
Genomic Location:
Chromosome 13 (position 40537527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGTRAAATMATGTCTTTGAACAGCAACTGCTTTCATCTGTTTCTTC[A/T]GGACTTCATAAACGCTTTTCATGYTACAATTATGGYGATCAAGGSATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fzj8iruk