grnb

Ensembl ID:
ENSDARG00000025081
ZFIN ID:
ZDB-GENE-030131-7393
Description:
granulin b [Source:RefSeq peptide;Acc:NP_997903]
Human Orthologue:
GRN
Human Description:
granulin [Source:HGNC Symbol;Acc:4601]
Mouse Orthologue:
Grn
Mouse Description:
granulin Gene [Source:MGI Symbol;Acc:MGI:95832]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37944 Nonsense Mutation detected in F1 DNA During 2017
sa30129 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105686 Nonsense 490 729 13 16
ENSDART00000142264   None 26 None 3
Genomic Location (Zv9):
Chromosome 24 (position 37854599)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36469515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTGGCTCAGAGTAGCTGTGTGCGTTCTGGCCTTCCTAGCATGGCATG[G/A]TTCAGGAAGGAGCCTGCGCTGAGAGAAACCCAGCGGGTCGAGGACAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105686 Nonsense 631 729 15 16
ENSDART00000142264   None 26 None 3
Genomic Location (Zv9):
Chromosome 24 (position 37858985)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36473901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGTGTTTTGTGCAGGCCGTGTGCTGTGAGGATCATGAGCACTGCTG[T/A]CCACAGGGCTACATCTGTAAGCTGGAGTTAGGGACGTGTGAGAAAGCGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link