marveld2a

Ensembl ID:
ENSDARG00000025076
ZFIN ID:
ZDB-GENE-050411-59
Description:
LOC558720 protein [Source:UniProtKB/TrEMBL;Acc:Q32PL4]
Human Orthologue:
MARVELD2
Human Description:
MARVEL domain containing 2 [Source:HGNC Symbol;Acc:26401]
Mouse Orthologue:
Marveld2
Mouse Description:
MARVEL (membrane-associating) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2446166]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30929 Nonsense Mutation detected in F1 DNA During 2015
sa24862 Nonsense Mutation detected in F1 DNA During 2015
sa14139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006772 Nonsense 275 545 1 6
ENSDART00000132526 Nonsense 275 545 4 9
Genomic Location:
Chromosome 10 (position 2987034)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCTTGTCTTGGGAATGACCATGTACTATCAGACTATACTTCTAGACT[C/A]AAGTTGGTGGCCTTTAACAGAGTTCGTCATAAACCTTGCTCTTGCACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006772 Nonsense 312 545 1 6
ENSDART00000132526 Nonsense 312 545 4 9
Genomic Location:
Chromosome 10 (position 2986922)
KASP Assay ID:
554-7623.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGCTGTGTATATGTGAATGACACCTTACGAGGCGGACTTTGTTACTA[T/A]CCGGTCTTCAATAATGGCATCAATGGTGCTTTCTGCCGCACCGAAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006772 Nonsense 428 545 3 6
ENSDART00000132526 Nonsense 428 545 6 9
Genomic Location:
Chromosome 10 (position 2983048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACACATTCCAGCGGGACACAMTCCTAAACCTGTGATCATGCCGGATTA[T/A]GTTGCGTGAGTACAGTTGTGCAAAAACACAANNNNACTATTACTGTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3j1n0foz