marveld2a

Ensembl ID:
ENSDARG00000025076
ZFIN ID:
ZDB-GENE-050411-59
Description:
LOC558720 protein [Source:UniProtKB/TrEMBL;Acc:Q32PL4]
Human Orthologue:
MARVELD2
Human Description:
MARVEL domain containing 2 [Source:HGNC Symbol;Acc:26401]
Mouse Orthologue:
Marveld2
Mouse Description:
MARVEL (membrane-associating) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2446166]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24862 Nonsense Mutation detected in F1 DNA During 2014
sa14139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006772 Nonsense 312 545 1 6
ENSDART00000132526 Nonsense 312 545 4 9
Genomic Location:
Chromosome 10 (position 2986922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGCTGTGTATATGTGAATGACACCTTACGAGGCGGACTTTGTTACTA[T/A]CCGGTCTTCAATAATGGCATCAATGGTGCTTTCTGCCGCACCGAAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006772 Nonsense 428 545 3 6
ENSDART00000132526 Nonsense 428 545 6 9
Genomic Location:
Chromosome 10 (position 2983048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACACATTCCAGCGGGACACAMTCCTAAACCTGTGATCATGCCGGATTA[T/A]GTTGCGTGAGTACAGTTGTGCAAAAACACAANNNNACTATTACTGTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3j1n0foz