brd8

Ensembl ID:
ENSDARG00000025071
ZFIN ID:
ZDB-GENE-030722-10
Description:
Bromodomain containing 8 [Source:UniProtKB/TrEMBL;Acc:Q6PFM2]
Human Orthologue:
BRD8
Human Description:
bromodomain containing 8 [Source:HGNC Symbol;Acc:19874]
Mouse Orthologues:
4933408B17Rik, Brd8
Mouse Descriptions:
bromodomain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1925906]
RIKEN cDNA 4933408B17 gene Gene [Source:MGI Symbol;Acc:MGI:3045347]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31973 Essential Splice Site Mutation detected in F1 DNA During 2016
sa265 Nonsense Confirmed mutation in F2 line During 2016
sa15090 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028623 Essential Splice Site None 840 1 19
ENSDART00000123139   None 849 None 19

The following transcripts of ENSDARG00000025071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 7665892)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7391371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATCGACAGTCCGGGCGCCGACGAACTAAAAAGAAACACAAAAGAAGG[T/A]AAGTTTATAATCATTTTGTTTATTTTGAAACTTTTTTGTTGTATATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa265
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028623 Nonsense 443 840 13 19
ENSDART00000123139 Nonsense 452 849 13 19

The following transcripts of ENSDARG00000025071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 7685694)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7411173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCTCTGTGAGGATCCAGCAGTCGGAGGTCACCCCCTCACCAGCCCCT[G/A]GGAATCACAGACATTTAAGGCAGCCGAACCAGAGCCTATGATCCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028623 Essential Splice Site 574 840 13 19
ENSDART00000123139 Essential Splice Site 583 849 13 19

The following transcripts of ENSDARG00000025071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 7686089)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7411568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YWCCCTGTCTGGATTCAGAAGATAGCTCGGCCTCAGCAAAAGATGYAAAG[G/A]TATYAGCAAAGCAAAAKGAAAAGTATGCCTTTATGTACAATGCTRWTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link