trip13

Ensembl ID:
ENSDARG00000025043
ZFIN ID:
ZDB-GENE-040426-1488
Description:
thyroid receptor-interacting protein 13 [Source:RefSeq peptide;Acc:NP_956876]
Human Orthologue:
TRIP13
Human Description:
thyroid hormone receptor interactor 13 [Source:HGNC Symbol;Acc:12307]
Mouse Orthologue:
Trip13
Mouse Description:
thyroid hormone receptor interactor 13 Gene [Source:MGI Symbol;Acc:MGI:1916966]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22960 Nonsense Mutation detected in F1 DNA During 2014
sa14564 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049099 Nonsense 196 424 8 14
Genomic Location:
Chromosome 16 (position 56508377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGGTATGAACCCCTTTATTTAGCACTGCCCACTGTTTATTTCAGGTA[T/A]GCACACAGCCAGTTTGTGGAGATCAACAGCCACAGTCTCTTCTCCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049099 Nonsense 363 424 12 14
Genomic Location:
Chromosome 16 (position 56515703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACTGGAAACCATGAACTTCATGGAGAGCGACGTGACCCGCCTGAGCT[T/A]ATGTCTGATGAAMATCTCTCAGTGAGTGTTTGACGGAGACACAAACTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hpvzwil3