nr3c1

Ensembl ID:
ENSDARG00000025032
ZFIN ID:
ZDB-GENE-050522-503
Description:
glucocorticoid receptor [Source:RefSeq peptide;Acc:NP_001018547]
Human Orthologue:
NR3C1
Human Description:
nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) [Source:HGNC Symbol;Acc:79
Mouse Orthologue:
Nr3c1
Mouse Description:
nuclear receptor subfamily 3, group C, member 1 Gene [Source:MGI Symbol;Acc:MGI:95824]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17694 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054264 Nonsense 426 746 4 9
ENSDART00000124144 Nonsense 426 746 3 8
ENSDART00000124401 Nonsense 426 471 3 3
Genomic Location (Zv9):
Chromosome 14 (position 24667617)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23466141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAMCTTTTTTYGWTTTTCATAGGGCAACACAATTACCTGTGTGCTGGG[C/T]GAAACGATTGCATCATTGACAAAATCCGCCGGAAGAACTGCCCTGCCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link