gpsm2l

Ensembl ID:
ENSDARG00000025027
ZFIN ID:
ZDB-GENE-041010-223
Description:
G-protein signalling modulator 2, like [Source:RefSeq peptide;Acc:NP_001005936]
Human Orthologue:
GPSM2
Human Description:
G-protein signaling modulator 2 [Source:HGNC Symbol;Acc:29501]
Mouse Orthologue:
Gpsm2
Mouse Description:
G-protein signalling modulator 2 (AGS3-like, C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1923373]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25199 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038405 Essential Splice Site 166 298 3 6
Genomic Location (Zv9):
Chromosome 23 (position 40459820)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40268552
KASP Assay ID:
554-7799.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCAGAAGAGGCACACATCGCGCTGAAGAAAGCGACAGAGTTATACGA[G/A]TGAGACACACACAAGTTGCCATAGAGTGAAAATCTGGATAAACAGTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link