prdm8

Ensembl ID:
ENSDARG00000025017
ZFIN ID:
ZDB-GENE-040426-2747
Description:
PR domain containing 8 [Source:RefSeq peptide;Acc:NP_998575]
Human Orthologue:
PRDM8
Human Description:
PR domain containing 8 [Source:HGNC Symbol;Acc:13993]
Mouse Orthologue:
Prdm8
Mouse Description:
PR domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1924880]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31938 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030946 Nonsense 38 502 2 4
Genomic Location (Zv9):
Chromosome 13 (position 31519304)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31165252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCGCGGATTTCTTCAGCAGTGTTCAAGTTACACAGGACATACCAGCT[G/T]GAACCTCATTTGGACCTTGTGTTCTTCATAACACTTTTTATGACACCATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link